Unix Commands for Pathogen Genomics - Practical Tutorial¶
Adapted from Microbial-Genomics practice scripts
Tutorial Overview¶
What You'll Learn¶
This hands-on tutorial will teach you essential Unix commands for pathogen genomics analysis. By the end, you'll be able to: - Navigate and organize genomics project directories - Process FASTQ and FASTA files efficiently - Extract meaningful information from sequencing data - Build simple analysis pipelines - Prepare data for HPC analysis
Prerequisites¶
- Basic terminal/command line access
- No prior Unix experience required
- Access to the training server
Time Required¶
- Complete tutorial: 2-3 hours
- Quick essentials: 45 minutes
Learning Path¶
- Setup → 2. Basic Navigation → 3. File Operations → 4. Data Processing → 5. Pipeline Building
Setup Instructions¶
Before starting the Unix command exercises, you need to prepare your workspace with sample genomics data. Here's how:
Step 1: Create Your Practice Directory¶
# Create a new directory for your practice exercises
# mkdir = "make directory"
# -p = create parent directories if needed (won't error if directory exists)
# ~ = shortcut for your home directory (/home/username)
mkdir -p ~/hpc_practice
# Navigate into your new directory
# cd = "change directory"
cd ~/hpc_practice
Step 2: Copy Sample Genomics Data¶
# Copy all sample files from the shared course folder to your current location
# cp = "copy" command
# -r = "recursive" - copy directories and all their contents
# * = wildcard that matches all files
# . = current directory (destination)
cp -r /cbio/training/courses/2025/micmet-genomics/sample-data/* .
Step 3: Verify Your Files¶
# List all files with details to confirm the copy was successful
# ls = "list" command
# -l = long format (shows permissions, size, dates)
# -a = show all files (including hidden files starting with .)
ls -la
Understanding Your Sample Files¶
The following files are now in your directory for practice:
| File | Description | Used For |
|---|---|---|
sample.fastq.gz |
Compressed DNA sequencing reads | Learning zcat, gunzip, file compression |
sample1.fastq |
Uncompressed sequencing data (3 reads) | Practicing grep, wc, sequence counting |
sample2.fastq |
Another FASTQ file (2 reads) | Array processing, file comparisons |
reference.fasta |
Reference genome sequences | Learning grep with FASTA headers, sequence extraction |
data.txt |
Tab-delimited sample metadata | Practicing awk, sed, cut, sort commands |
File Formats Explained: - FASTQ: Contains sequences + quality scores (4 lines per read) - FASTA: Contains sequences only (2 lines per sequence: header + sequence) - GZ: Gzip compressed file (saves space, common in genomics)
Quick Command Reference with Detailed Explanations¶
Essential Commands for Genomics Analysis¶
Before diving into detailed modules, here's a quick reference of the most commonly used commands in pathogen genomics, with detailed explanations of what each component does:
Navigate and Organize¶
# Create nested directories for a genomics project
mkdir -p project/{data,results,scripts}
# Explanation:
# mkdir = make directory command
# -p = create parent directories as needed (won't error if they exist)
# project/ = main project folder
# {data,results,scripts} = brace expansion creates 3 subdirectories at once
# - data/ for raw sequencing files
# - results/ for analysis outputs
# - scripts/ for your analysis code
# Navigate to your project directory
cd project
# cd = change directory
# project = destination directory (relative path from current location)
# Show current working directory
pwd
# pwd = print working directory
# Returns absolute path like: /home/username/hpc_practice/project
Inspect FASTQ Files¶
# View compressed FASTQ file content
zcat sample.fastq.gz | head -20
# Explanation:
# zcat = view compressed file without extracting (z = gzip, cat = concatenate)
# sample.fastq.gz = compressed FASTQ file (common in genomics to save space)
# | = pipe operator, sends output to next command
# head -20 = show first 20 lines (5 complete reads since FASTQ uses 4 lines/read)
# Count number of reads in FASTQ file
zcat sample.fastq.gz | wc -l | awk '{print $1/4}'
# Explanation:
# zcat sample.fastq.gz = decompress and output file content
# wc -l = word count with -l flag counts lines
# | = pipe the line count to awk
# awk '{print $1/4}' = divide line count by 4 (FASTQ has 4 lines per read)
# - $1 = first field (the line count)
# - /4 = division to get read count
# Example: 400 lines / 4 = 100 reads
Search and Filter¶
# Find all FASTA headers in reference genome
grep "^>" reference.fasta
# Explanation:
# grep = global regular expression print (searches for patterns)
# "^>" = pattern to search for
# - ^ = start of line anchor (line must begin with >)
# - > = literal ">" character (FASTA headers start with >)
# reference.fasta = file to search in
# Output: Shows all sequence headers like ">chr1", ">gene_ABC123"
# Count high-quality variants
grep -c "PASS" variants.vcf
# Explanation:
# grep = search command
# -c = count matching lines instead of showing them
# "PASS" = quality filter status in VCF files
# variants.vcf = variant call format file
# Returns: Number like "1234" (count of variants passing quality filters)
Process Text Data¶
# Extract specific columns from data
awk '{print $1, $2}' data.txt
# Explanation:
# awk = powerful text processing tool
# '{print $1, $2}' = awk program
# - {} = action block
# - print = output command
# - $1 = first column/field
# - $2 = second column/field
# - , = adds space between fields in output
# data.txt = input file
# Example input: "Sample1 100 resistant"
# Example output: "Sample1 100"
# Replace text in files
sed 's/old/new/g' file.txt
# Explanation:
# sed = stream editor for text transformation
# 's/old/new/g' = substitution command
# - s = substitute command
# - /old/ = pattern to find
# - /new/ = replacement text
# - g = global flag (replace all occurrences, not just first)
# file.txt = input file
# Example: Changes "old_sample_name" to "new_sample_name" throughout file
Combined Pipeline Examples¶
Example 1: Quick FASTQ Quality Check¶
# Count reads and check quality score distribution
zcat sample.fastq.gz | \
awk 'NR%4==0' | \
cut -c1-10 | \
sort | \
uniq -c | \
sort -rn
# Line-by-line explanation:
# zcat sample.fastq.gz = decompress FASTQ
# awk 'NR%4==0' = get every 4th line (quality scores)
# - NR = line number
# - %4==0 = divisible by 4 (4th, 8th, 12th lines...)
# cut -c1-10 = first 10 characters of quality string
# sort = alphabetically sort quality patterns
# uniq -c = count unique patterns
# sort -rn = sort by count, highest first
# - -r = reverse order
# - -n = numerical sort
Example 2: Extract High-Quality Reads¶
# Get read IDs with average quality > 30
zcat sample.fastq.gz | \
paste - - - - | \
awk '{if(length($4) > 0) print $1, length($4)}' | \
grep "^@"
# Explanation:
# paste - - - - = combine every 4 lines into 1 tab-delimited line
# awk = process the combined lines
# $1 = read ID, $4 = quality string
# grep "^@" = filter for valid read IDs
Pro Tips for These Commands¶
-
Always preview before processing:
-
Count before and after filtering:
-
Use quotes for patterns with special characters:
-
Combine commands efficiently:
Module 1: Directory Organization for Genomics Projects¶
Learning Objectives¶
✓ Create organized project directories ✓ Navigate between directories efficiently ✓ Understand genomics project structure
Tutorial 1.1: Creating Your First Project Structure¶
Step 1: Start with a Simple Structure¶
# Create your main project directory
mkdir my_first_project
# Enter the directory
cd my_first_project
# Check where you are
pwd
# Output: /home/username/hpc_practice/my_first_project
Step 2: Add Subdirectories¶
# Create data directories
mkdir data
mkdir results
mkdir scripts
# List what you created
ls
# Output: data results scripts
Step 3: Create a Complex Structure¶
# Use -p to create nested directories
mkdir -p data/{raw_reads,reference_genomes,metadata}
mkdir -p results/{qc,alignment,variants,phylogeny}
mkdir -p scripts logs tmp
# View the structure
ls -la
# The -la flags show: l=long format, a=all files
Try It Yourself:
# Exercise: Create this structure
# project/
# ├── input/
# │ ├── sequences/
# │ └── references/
# └── output/
# ├── aligned/
# └── reports/
# Solution:
mkdir -p project/{input/{sequences,references},output/{aligned,reports}}
Real-world application:
# Set up M. tuberculosis outbreak analysis
mkdir -p mtb_outbreak_2025/{data,results,scripts,logs}
cd mtb_outbreak_2025
mkdir -p data/{fastq,references,clinical_metadata}
mkdir -p results/{fastqc,trimming,bwa_alignment,vcf_files,phylogenetic_tree}
Module 2: File Management for Sequencing Data¶
Learning Objectives¶
✓ Create and edit text files ✓ Copy and rename sequencing files ✓ Organize data systematically
Tutorial 2.1: Working with Sample Lists¶
Step 1: Create a Sample List¶
# First, ensure you're in the right place
pwd
cd ~/hpc_practice
# Create an empty file
touch sample_list.txt
# Check it was created
ls -la sample_list.txt
# Output: -rw-r--r-- 1 user group 0 Sep 2 10:00 sample_list.txt
Step 2: Add Content to the File¶
# Method 1: Using echo (for single lines)
echo "Sample_001" > sample_list.txt
echo "Sample_002" >> sample_list.txt # >> appends, > overwrites!
# Method 2: Using nano editor (recommended for multiple lines)
nano sample_list.txt
# Type or paste the following content:
# MTB_sample_001
# MTB_sample_002
# MTB_sample_003
# MTB_sample_004
# Then save with: Ctrl+X, Y, Enter
# View what you created
cat sample_list.txt
Step 3: Count and Verify¶
# Count lines in file
wc -l sample_list.txt
# Output: 4 sample_list.txt
# Count words
wc -w sample_list.txt
# Output: 4 sample_list.txt
# Get full statistics
wc sample_list.txt
# Output: 4 4 58 sample_list.txt
# (lines, words, characters)
Tutorial 2.2: Organizing Sequencing Files¶
Step 1: Copy Files Safely¶
# Copy sample files to practice with
cp sample*.fastq .
# List files before renaming
ls sample*.fastq
# Output: sample1.fastq sample2.fastq
# Create a backup first (always!)
mkdir backups
cp sample*.fastq backups/
Step 2: Rename Files Systematically¶
# Rename a single file
mv sample1.fastq patient001_reads.fastq
# Batch rename using a loop
for file in sample*.fastq; do
# Extract the number from filename
num=$(echo $file | grep -o '[0-9]\+')
# Create new name
newname="patient_${num}_sequences.fastq"
echo "Renaming $file to $newname"
mv "$file" "$newname"
done
# Verify the renaming
ls *.fastq
Practice Exercise:¶
# Exercise: Create copies with dates
# Copy sample.fastq.gz to sample_20250902.fastq.gz
# Solution:
date_stamp=$(date +%Y%m%d)
cp sample.fastq.gz sample_${date_stamp}.fastq.gz
Module 3: Viewing and Inspecting Genomics Files¶
Learning Objectives¶
✓ View compressed and uncompressed files ✓ Count sequences in FASTQ/FASTA files ✓ Extract specific parts of files
Tutorial 3.1: Working with FASTQ Files¶
Step 1: View Compressed Files¶
# View first 4 lines (1 complete read) of compressed file
zcat sample.fastq.gz | head -4
# Output:
# @SEQ_001
# ACGTACGTACGTACGTACGTACGTACGTACGTACGT
# +
# IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
# View first 2 reads (8 lines)
zcat sample.fastq.gz | head -8
Step 2: Count Sequences¶
# Count total lines
zcat sample.fastq.gz | wc -l
# Output: 12 (for 3 reads)
# Count number of reads (FASTQ has 4 lines per read)
zcat sample.fastq.gz | wc -l | awk '{print $1/4}'
# Output: 3
# Alternative: Count sequence headers
zcat sample.fastq.gz | grep -c "^@"
# Output: 3
Step 3: View with Line Numbers¶
# Add line numbers to output
zcat sample.fastq.gz | head -8 | cat -n
# Output:
# 1 @SEQ_001
# 2 ACGTACGTACGTACGTACGTACGTACGTACGTACGT
# 3 +
# 4 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
# 5 @SEQ_002
# 6 TGCATGCATGCATGCATGCATGCATGCATGCATGCA
# 7 +
# 8 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
Tutorial 3.2: Working with FASTA Files¶
Step 1: View FASTA Headers¶
# View first line (header) of FASTA
head -1 reference.fasta
# Output: >Sequence_1 gene=ABC123
# View all headers in file
grep "^>" reference.fasta
# Output:
# >Sequence_1 gene=ABC123
# >Sequence_2 gene=DEF456
# Count sequences
grep -c "^>" reference.fasta
# Output: 2
Step 2: Extract Sequences¶
# View first 2 lines (header + sequence start)
head -2 reference.fasta
# Skip header, view sequence only
tail -n +2 reference.fasta | head -1
# Output: ACGTACGTACGTACGTACGTACGTACGTACGTACGT
# Get sequence length
tail -n +2 reference.fasta | head -1 | wc -c
# Output: 37 (includes newline)
Practice Exercise:¶
# Exercise: Count total bases in all sequences
# Hint: Remove headers first
# Solution:
grep -v "^>" reference.fasta | tr -d '\n' | wc -c
Module 4: Searching and Filtering Genomics Data¶
Learning Objectives¶
✓ Search for patterns in files ✓ Filter genomics data ✓ Use regular expressions
Tutorial 4.1: Basic Pattern Searching¶
Step 1: Simple Searches¶
# Search for a word in a file
grep "resistant" data.txt
# Output: Sample1 100 resistant
# Sample3 150 resistant
# Case-insensitive search (-i flag)
grep -i "SAMPLE" data.txt
# Finds: Sample1, Sample2, etc.
# Count matches (-c flag)
grep -c "resistant" data.txt
# Output: 2
# Show line numbers (-n flag)
grep -n "resistant" data.txt
# Output: 1:Sample1 100 resistant
# 3:Sample3 150 resistant
Step 2: Search in Genomics Files¶
# Find sequence headers in FASTA
grep "^>" reference.fasta
# ^ means "start of line"
# Find adapter sequences in FASTQ
grep "AGATCGGAAGAG" sample1.fastq
# Search compressed files
zcat sample.fastq.gz | grep "ACGT"
Tutorial 4.2: Advanced Pattern Matching¶
Using Regular Expressions¶
# Find lines with numbers
grep '[0-9]' data.txt
# [0-9] matches any digit
# Find lines ending with specific pattern
grep 'resistant$' data.txt
# $ means "end of line"
# Extract only the matching part (-o flag)
echo "Sample123" | grep -o '[0-9]\+'
# Output: 123
# \+ means "one or more"
# Multiple patterns (OR)
grep -E 'resistant|sensitive' data.txt
# -E enables extended regex
Practice Exercise:¶
# Exercise: Find all samples with values > 150
# Hint: Use awk instead of grep for numeric comparisons
# Solution:
awk '$2 > 150' data.txt
# Output: Sample2 200 sensitive
# Sample4 300 sensitive
Module 5: Text Processing for Genomics¶
Learning Objectives¶
✓ Extract specific columns from files ✓ Perform calculations on data ✓ Transform text efficiently
Tutorial 5.1: Using awk for Data Processing¶
Step 1: Extract Columns¶
# Print specific columns (1st and 2nd)
awk '{print $1, $2}' data.txt
# Output: Sample1 100
# Sample2 200
# Sample3 150
# Sample4 300
# Print with custom separator
awk '{print $1 "," $2}' data.txt
# Output: Sample1,100
# Add text to output
awk '{print "Sample:" $1 " Value:" $2}' data.txt
Step 2: Perform Calculations¶
# Sum values in column 2
awk '{sum+=$2} END {print "Total:", sum}' data.txt
# Output: Total: 750
# Calculate average
awk '{sum+=$2; count++} END {print "Average:", sum/count}' data.txt
# Output: Average: 187.5
# Filter based on value
awk '$2 > 150 {print $0}' data.txt
# Output: Sample2 200 sensitive
# Sample4 300 sensitive
Tutorial 5.2: Using sed for Text Manipulation¶
Step 1: Basic Substitutions¶
# Replace text (s = substitute)
echo "Sample1" | sed 's/1/A/'
# Output: SampleA
# Global replacement (g = global)
echo "Sample111" | sed 's/1/A/g'
# Output: SampleAAA
# Replace in file and save
sed 's/Sample/Patient/g' data.txt > patients.txt
# Edit file in place (careful!)
sed -i.bak 's/Sample/Patient/g' data.txt
# Creates data.txt.bak as backup
Step 2: Advanced Manipulations¶
# Delete lines containing pattern
sed '/sensitive/d' data.txt
# Removes lines with "sensitive"
# Add text to beginning of lines
sed 's/^/PREFIX_/' data.txt
# Adds PREFIX_ to each line start
# Convert spaces to tabs
sed 's/ /\t/g' data.txt > data.tsv
6. File Permissions and Management¶
Managing Permissions¶
# Make scripts executable
chmod +x scripts/analysis_pipeline.sh
# Protect raw data from accidental modification
chmod 444 data/raw_reads/*.fastq.gz
# Set directory permissions
chmod 755 results/
# Check permissions
ls -la data/raw_reads/
7. Sorting and Unique Operations¶
Processing Sample Lists¶
# Sort sample names
sort data/sample_list.txt
# Sort numerically by coverage
sort -k2 -n coverage_stats.txt
# Get unique mutations
cut -f1,2 variants.txt | sort | uniq
# Count occurrences of each mutation
cut -f3 mutations.txt | sort | uniq -c | sort -rn
8. Pipelines and Redirection¶
Creating Simple Analysis Pipelines¶
# Count reads per sample and save to file
for file in data/raw_reads/*.fastq.gz; do
sample=$(basename $file .fastq.gz)
count=$(zcat $file | wc -l | awk '{print $1/4}')
echo -e "$sample\t$count"
done > results/qc/read_counts.txt
# Extract and count specific genes
grep "^>" reference.fasta | cut -d' ' -f1 | sed 's/>//' | sort | uniq -c > gene_counts.txt
# Process multiple VCF files
for vcf in results/variants/*.vcf; do
sample=$(basename $vcf .vcf)
pass_count=$(grep -c "PASS" $vcf)
total_count=$(grep -v "^#" $vcf | wc -l)
echo -e "$sample\t$total_count\t$pass_count"
done > results/variant_summary.txt
9. Practical SLURM Integration¶
Preparing Files for HPC Analysis¶
To create a SLURM job script:
Copy and paste the following content:
#!/bin/bash
#SBATCH --job-name=prep_pathogen_data
#SBATCH --time=00:30:00
#SBATCH --mem=4GB
# Create directory structure
mkdir -p ${SLURM_JOB_ID}_analysis/{data,results,logs}
# Copy and organize files
cp /shared/data/*.fastq.gz ${SLURM_JOB_ID}_analysis/data/
# Generate file list for processing
ls ${SLURM_JOB_ID}_analysis/data/*.fastq.gz > file_list.txt
# Count and verify files
echo "Total files to process: $(wc -l < file_list.txt)"
# Create metadata file
for file in ${SLURM_JOB_ID}_analysis/data/*.fastq.gz; do
size=$(du -h $file | cut -f1)
reads=$(zcat $file | wc -l | awk '{print $1/4}')
echo "$(basename $file)\t$size\t$reads"
done > ${SLURM_JOB_ID}_analysis/data/file_metadata.tsv
echo "Preparation complete. Ready for analysis."
Save the file with: Ctrl+X, then Y, then Enter
Submit the job with: sbatch prep_pathogen_data.sh
Hands-On Exercise: Complete Pathogen Analysis Workflow¶
Exercise Overview¶
Build a complete analysis pipeline step-by-step, applying all the skills you've learned.
Part 1: Setup and Data Preparation¶
# Step 1: Create project structure
mkdir -p pathogen_practice/{data,results,scripts}
cd pathogen_practice
pwd # Verify you're in the right place
# Step 2: Create sample metadata
nano data/samples.txt
# Paste the following content:
# Mtb_patient_001_resistant
# Mtb_patient_002_susceptible
# Mtb_patient_003_resistant
# Salmonella_outbreak_001
# Salmonella_outbreak_002
# Save with: Ctrl+X, Y, Enter
# Verify the file was created
cat data/samples.txt
Part 2: Data Analysis Tasks¶
Task 1: Find Resistant Samples¶
# Use grep to find resistant samples
grep "resistant" data/samples.txt
# Save results to file
grep "resistant" data/samples.txt > results/resistant_samples.txt
# Count how many
grep -c "resistant" data/samples.txt
Task 2: Count by Pathogen Type¶
# Count MTB samples
grep -c "Mtb" data/samples.txt
# Count Salmonella samples
grep -c "Salmonella" data/samples.txt
# Save counts
echo "MTB samples: $(grep -c 'Mtb' data/samples.txt)" > results/pathogen_counts.txt
echo "Salmonella samples: $(grep -c 'Salmonella' data/samples.txt)" >> results/pathogen_counts.txt
Task 3: Generate Summary Report¶
# Create a comprehensive summary using nano
nano results/summary_report.txt
# Type the following content (replace the values with actual counts):
# === Pathogen Analysis Summary ===
# Date: [current date]
# Total samples: 5
# Resistant samples: 2
# Susceptible samples: 1
# MTB samples: 3
# Salmonella samples: 2
# =================================
# Save with: Ctrl+X, Y, Enter
# Or use echo commands to generate it automatically:
echo "=== Pathogen Analysis Summary ===" > results/summary_report.txt
echo "Date: $(date)" >> results/summary_report.txt
echo "Total samples: $(wc -l < data/samples.txt)" >> results/summary_report.txt
echo "Resistant samples: $(grep -c "resistant" data/samples.txt)" >> results/summary_report.txt
echo "Susceptible samples: $(grep -c "susceptible" data/samples.txt)" >> results/summary_report.txt
echo "MTB samples: $(grep -c "Mtb" data/samples.txt)" >> results/summary_report.txt
echo "Salmonella samples: $(grep -c "Salmonella" data/samples.txt)" >> results/summary_report.txt
echo "=================================" >> results/summary_report.txt
# Display the report
cat results/summary_report.txt
Part 3: Challenge Exercises¶
Challenge 1: Extract Sample IDs¶
# Extract just the patient IDs (hint: use cut or awk)
# Try it yourself first!
# Solution:
cut -d'_' -f2,3 data/samples.txt
# Or using awk:
awk -F'_' '{print $2"_"$3}' data/samples.txt
Challenge 2: Sort and Count Unique Pathogens¶
# Extract pathogen names and count occurrences
# Try it yourself first!
# Solution:
cut -d'_' -f1 data/samples.txt | sort | uniq -c
Challenge 3: Create a Pipeline¶
# Find all resistant MTB samples in one command
# Try it yourself first!
# Solution:
grep "Mtb" data/samples.txt | grep "resistant"
# Or more elegantly:
grep "Mtb.*resistant" data/samples.txt
Tips for Pathogen Genomics Unix Usage¶
- Always work with copies of raw sequencing data
- Use meaningful file names with sample IDs and dates
- Document your commands in scripts for reproducibility
- Check file integrity after transfers (md5sum)
- Compress large files to save space (gzip/bgzip)
- Use screen or tmux for long-running processes
- Regular backups of analysis results
- Version control for scripts (git)
Common File Formats in Pathogen Genomics¶
| Extension | Format | View Command | Description |
|---|---|---|---|
.fastq.gz |
Compressed FASTQ | zcat file.fastq.gz \| head |
Raw sequencing reads |
.fasta |
FASTA | cat file.fasta |
Reference genomes |
.sam/.bam |
SAM/BAM | samtools view file.bam \| head |
Alignments |
.vcf |
VCF | cat file.vcf |
Variant calls |
.gff/.gtf |
GFF/GTF | cat file.gff |
Gene annotations |
.newick/.tree |
Newick | cat file.tree |
Phylogenetic trees |
Troubleshooting Guide¶
Common Issues and Solutions¶
Issue 1: "Permission denied"¶
# Problem: Can't access or modify a file
# Solution: Check permissions
ls -la filename
# Fix: Change permissions if you own the file
chmod u+rw filename
Issue 2: "No such file or directory"¶
# Problem: File path is wrong
# Solution: Check your current location
pwd
# List files to verify
ls -la
# Use absolute paths to be sure
/full/path/to/file
Issue 3: "Command not found"¶
# Problem: Tool not installed or not in PATH
# Solution: Check if command exists
which command_name
# Load module if available
module avail
module load tool_name
Issue 4: File is empty or corrupted¶
# Check file size
ls -lh filename
# Check file type
file filename
# For compressed files, test integrity
gzip -t file.gz
Issue 5: Out of disk space¶
# Check available space
df -h
# Find large files
du -sh * | sort -h
# Clean up temporary files
rm -rf tmp/*
Best Practices to Avoid Issues¶
-
Always backup before modifying
-
Use tab completion to avoid typos
-
Preview commands with echo first
-
Check file contents before processing
Quick Reference Card¶
Essential Commands Summary¶
| Task | Command | Example |
|---|---|---|
| List files | ls -la |
ls -la *.fastq |
| Change directory | cd |
cd ~/hpc_practice |
| Create directory | mkdir -p |
mkdir -p data/reads |
| Copy files | cp -r |
cp sample.fastq backup/ |
| Move/rename | mv |
mv old.txt new.txt |
| View compressed | zcat |
zcat file.gz \| head |
| Count lines | wc -l |
wc -l sample.txt |
| Search text | grep |
grep "pattern" file |
| Extract columns | awk |
awk '{print $1}' file |
| Replace text | sed |
sed 's/old/new/g' file |
| Sort data | sort |
sort -n numbers.txt |
| Get unique | uniq |
sort file \| uniq |
Next Steps¶
After mastering these Unix commands, you're ready to: 1. Submit SLURM jobs - See High Performance Computing with SLURM: Practical Tutorial 2. Learn HPC concepts - See HPC and ILIFU Training Materials 3. Build analysis pipelines with Nextflow 4. Perform quality control with FastQC 5. Align reads with BWA 6. Call variants with SAMtools/BCFtools
Remember: Unix commands are the foundation of all bioinformatics pipelines!